INTERLEUKIN-27 RS153109 POLYMORPHISM AND THE RISK FOR ACQUIRED APLASTIC ANEMIA IN A CHINESE POPULATION
(Abstract release date: 05/19/16)
EHA Library. Ge M. 06/09/16; 134659; PB1759
Dr. Meili Ge
Contributions
Contributions
Abstract
Abstract: PB1759
Type: Publication Only
Background
Acquired AA, characterized by pancytopenia in peripheral blood (PB) and bone marrow (BM) hypoplasia, is a BM failure syndrome attacked by autologous T cells on BM hematopoietic progenitors. Interleukin-27 (IL-27), as a novel heterodimeric cytokine of the IL-12 family, has been shown to play a vital role in the pathogenesis of aplastic anemia（AA）.The present studies demonstrated that IL-27 enhanced the production of TNF-α and IFN-γ in both CD4+ and CD8+ T lymphocytes from AA patients, and the elevated IL-27 and IL- 27-induced TNF-α and IFN-γ overproduction might be involved in the pathogenesis of AA.Among the IL-27 polymorphisms identified, the SNP of IL-27 rs153109 polymorphism has been reported to be associated with the risk of asthma, chronic obstructive pulmonary disease and inflammatory bowel diseases. To our knowledge, little is known about the role of the SNP of IL-27 in individual susceptibility to AA. To address this question, we have detected the IL-27 rs153109 polymorphism with an aim of identifying site(s) of variation, which may be helpful for better understanding the genetic influences of this gene. We herein performed a case-control study to investigate whether the IL-27 rs153109 polymorphism is associated with AA in Chinese people.
Aims
The aim of the present study was to investigate the association of single nucleotide polymorphisms (SNP) of IL-27 gene with the risk for aplastic anemia (AA).
Methods
Patients StudiedThe subjects comprised 205 AA patients (109 male and 96 female) with age range of (14–76 years) referred to our hospital, and 196 healthy controls from the employees of our hospital. The characteristics of the subjects are shown in Table 1.Extraction of Genomic DNAGenomic DNA was extracted using DNA Purification Kit (promega Cat. #A1125 Beijing, China) according to the manufacturer’s protocols. IL-27 rs153109 Genotyping by Polymerase Chain Reaction-restriction Fragment Length Polymorphism (PCR-RFLP)The genotyping of the TRAF1/C5 rs10818488 was performed by PCR-RFLP. The upstream primer 5΄- ACCAAGAAACCCCATCCTCT -3΄ and the downstream primer 5΄- TCAGTCAGTGACCAGGATCG -3΄ were used to generate a region of 224 bp of IL-27 gene. Genotyping for IL-27 rs153109 SNP was performed by restriction analysis using the PaeR7I restriction enzyme (New England Biolabs), which digests specifically DNA amplified from the G (but not the A) allele into 179-bp and 45-bp fragments. Both undigested and digested PCR products were visualized in 2% agarose gel stained with ethidium bromide. Genotypes were scored blindly, and analyses of all ambiguous samples were repeated.Statistical AnalysisSPSS16.0 (SPSS Inc., Chicago, IL) was used for statistics analysis. A p value <0.05 was considered to be statistically significant.
Results
In our study, the IL-27 rs153109 polymorphism genotypes between AA patients and healthy controls were first determined and compared. The frequencies of AA, AG and GG genotypes, and A and G alleles were 39.5%, 48.3%, 12.2%, 63.7% and 36.3%, respectively, in AA patients. There was no significant differences in terms of genotype and alleles distributions between AA patients and healthy controls (P=0.653 and 0.908, respectively).(Table 2). Furthermore, AA patients were further subdivided into three groups according to the disease serevity: vSAA, SAA, and NSAA. The distribution of this polymorphism genotype was compared between each of these three groups and the controls, respectively. No statistical differences were identified (Table 3).We also investigated whether the IL-27 rs153109 polymorphism could influence response to treatment. Nine of 205 (4.4%) patients were lost to follow-up. Responders included complete and partial responders. No significant correlations between the genotype and allele frequencies and response of treatment in this cohort of AA patients were observed (Table 4).
Conclusion
In conclusion, IL-27 rs153109 polymorphism may not play an important role as a genetic risk factor in the pathophysiology of AA in a Chinese population. More studies with larger sample are warranted to further confirm the role of IL-27 rs153109 polymorphism in determining the risk of AA.
Session topic: E-poster
Keyword(s): Aplastic anemia, Polymorphism
Type: Publication Only
Background
Acquired AA, characterized by pancytopenia in peripheral blood (PB) and bone marrow (BM) hypoplasia, is a BM failure syndrome attacked by autologous T cells on BM hematopoietic progenitors. Interleukin-27 (IL-27), as a novel heterodimeric cytokine of the IL-12 family, has been shown to play a vital role in the pathogenesis of aplastic anemia（AA）.The present studies demonstrated that IL-27 enhanced the production of TNF-α and IFN-γ in both CD4+ and CD8+ T lymphocytes from AA patients, and the elevated IL-27 and IL- 27-induced TNF-α and IFN-γ overproduction might be involved in the pathogenesis of AA.Among the IL-27 polymorphisms identified, the SNP of IL-27 rs153109 polymorphism has been reported to be associated with the risk of asthma, chronic obstructive pulmonary disease and inflammatory bowel diseases. To our knowledge, little is known about the role of the SNP of IL-27 in individual susceptibility to AA. To address this question, we have detected the IL-27 rs153109 polymorphism with an aim of identifying site(s) of variation, which may be helpful for better understanding the genetic influences of this gene. We herein performed a case-control study to investigate whether the IL-27 rs153109 polymorphism is associated with AA in Chinese people.
Aims
The aim of the present study was to investigate the association of single nucleotide polymorphisms (SNP) of IL-27 gene with the risk for aplastic anemia (AA).
Methods
Patients StudiedThe subjects comprised 205 AA patients (109 male and 96 female) with age range of (14–76 years) referred to our hospital, and 196 healthy controls from the employees of our hospital. The characteristics of the subjects are shown in Table 1.Extraction of Genomic DNAGenomic DNA was extracted using DNA Purification Kit (promega Cat. #A1125 Beijing, China) according to the manufacturer’s protocols. IL-27 rs153109 Genotyping by Polymerase Chain Reaction-restriction Fragment Length Polymorphism (PCR-RFLP)The genotyping of the TRAF1/C5 rs10818488 was performed by PCR-RFLP. The upstream primer 5΄- ACCAAGAAACCCCATCCTCT -3΄ and the downstream primer 5΄- TCAGTCAGTGACCAGGATCG -3΄ were used to generate a region of 224 bp of IL-27 gene. Genotyping for IL-27 rs153109 SNP was performed by restriction analysis using the PaeR7I restriction enzyme (New England Biolabs), which digests specifically DNA amplified from the G (but not the A) allele into 179-bp and 45-bp fragments. Both undigested and digested PCR products were visualized in 2% agarose gel stained with ethidium bromide. Genotypes were scored blindly, and analyses of all ambiguous samples were repeated.Statistical AnalysisSPSS16.0 (SPSS Inc., Chicago, IL) was used for statistics analysis. A p value <0.05 was considered to be statistically significant.
Results
In our study, the IL-27 rs153109 polymorphism genotypes between AA patients and healthy controls were first determined and compared. The frequencies of AA, AG and GG genotypes, and A and G alleles were 39.5%, 48.3%, 12.2%, 63.7% and 36.3%, respectively, in AA patients. There was no significant differences in terms of genotype and alleles distributions between AA patients and healthy controls (P=0.653 and 0.908, respectively).(Table 2). Furthermore, AA patients were further subdivided into three groups according to the disease serevity: vSAA, SAA, and NSAA. The distribution of this polymorphism genotype was compared between each of these three groups and the controls, respectively. No statistical differences were identified (Table 3).We also investigated whether the IL-27 rs153109 polymorphism could influence response to treatment. Nine of 205 (4.4%) patients were lost to follow-up. Responders included complete and partial responders. No significant correlations between the genotype and allele frequencies and response of treatment in this cohort of AA patients were observed (Table 4).
Conclusion
In conclusion, IL-27 rs153109 polymorphism may not play an important role as a genetic risk factor in the pathophysiology of AA in a Chinese population. More studies with larger sample are warranted to further confirm the role of IL-27 rs153109 polymorphism in determining the risk of AA.
Session topic: E-poster
Keyword(s): Aplastic anemia, Polymorphism
Abstract: PB1759
Type: Publication Only
Background
Acquired AA, characterized by pancytopenia in peripheral blood (PB) and bone marrow (BM) hypoplasia, is a BM failure syndrome attacked by autologous T cells on BM hematopoietic progenitors. Interleukin-27 (IL-27), as a novel heterodimeric cytokine of the IL-12 family, has been shown to play a vital role in the pathogenesis of aplastic anemia（AA）.The present studies demonstrated that IL-27 enhanced the production of TNF-α and IFN-γ in both CD4+ and CD8+ T lymphocytes from AA patients, and the elevated IL-27 and IL- 27-induced TNF-α and IFN-γ overproduction might be involved in the pathogenesis of AA.Among the IL-27 polymorphisms identified, the SNP of IL-27 rs153109 polymorphism has been reported to be associated with the risk of asthma, chronic obstructive pulmonary disease and inflammatory bowel diseases. To our knowledge, little is known about the role of the SNP of IL-27 in individual susceptibility to AA. To address this question, we have detected the IL-27 rs153109 polymorphism with an aim of identifying site(s) of variation, which may be helpful for better understanding the genetic influences of this gene. We herein performed a case-control study to investigate whether the IL-27 rs153109 polymorphism is associated with AA in Chinese people.
Aims
The aim of the present study was to investigate the association of single nucleotide polymorphisms (SNP) of IL-27 gene with the risk for aplastic anemia (AA).
Methods
Patients StudiedThe subjects comprised 205 AA patients (109 male and 96 female) with age range of (14–76 years) referred to our hospital, and 196 healthy controls from the employees of our hospital. The characteristics of the subjects are shown in Table 1.Extraction of Genomic DNAGenomic DNA was extracted using DNA Purification Kit (promega Cat. #A1125 Beijing, China) according to the manufacturer’s protocols. IL-27 rs153109 Genotyping by Polymerase Chain Reaction-restriction Fragment Length Polymorphism (PCR-RFLP)The genotyping of the TRAF1/C5 rs10818488 was performed by PCR-RFLP. The upstream primer 5΄- ACCAAGAAACCCCATCCTCT -3΄ and the downstream primer 5΄- TCAGTCAGTGACCAGGATCG -3΄ were used to generate a region of 224 bp of IL-27 gene. Genotyping for IL-27 rs153109 SNP was performed by restriction analysis using the PaeR7I restriction enzyme (New England Biolabs), which digests specifically DNA amplified from the G (but not the A) allele into 179-bp and 45-bp fragments. Both undigested and digested PCR products were visualized in 2% agarose gel stained with ethidium bromide. Genotypes were scored blindly, and analyses of all ambiguous samples were repeated.Statistical AnalysisSPSS16.0 (SPSS Inc., Chicago, IL) was used for statistics analysis. A p value <0.05 was considered to be statistically significant.
Results
In our study, the IL-27 rs153109 polymorphism genotypes between AA patients and healthy controls were first determined and compared. The frequencies of AA, AG and GG genotypes, and A and G alleles were 39.5%, 48.3%, 12.2%, 63.7% and 36.3%, respectively, in AA patients. There was no significant differences in terms of genotype and alleles distributions between AA patients and healthy controls (P=0.653 and 0.908, respectively).(Table 2). Furthermore, AA patients were further subdivided into three groups according to the disease serevity: vSAA, SAA, and NSAA. The distribution of this polymorphism genotype was compared between each of these three groups and the controls, respectively. No statistical differences were identified (Table 3).We also investigated whether the IL-27 rs153109 polymorphism could influence response to treatment. Nine of 205 (4.4%) patients were lost to follow-up. Responders included complete and partial responders. No significant correlations between the genotype and allele frequencies and response of treatment in this cohort of AA patients were observed (Table 4).
Conclusion
In conclusion, IL-27 rs153109 polymorphism may not play an important role as a genetic risk factor in the pathophysiology of AA in a Chinese population. More studies with larger sample are warranted to further confirm the role of IL-27 rs153109 polymorphism in determining the risk of AA.
Session topic: E-poster
Keyword(s): Aplastic anemia, Polymorphism
Type: Publication Only
Background
Acquired AA, characterized by pancytopenia in peripheral blood (PB) and bone marrow (BM) hypoplasia, is a BM failure syndrome attacked by autologous T cells on BM hematopoietic progenitors. Interleukin-27 (IL-27), as a novel heterodimeric cytokine of the IL-12 family, has been shown to play a vital role in the pathogenesis of aplastic anemia（AA）.The present studies demonstrated that IL-27 enhanced the production of TNF-α and IFN-γ in both CD4+ and CD8+ T lymphocytes from AA patients, and the elevated IL-27 and IL- 27-induced TNF-α and IFN-γ overproduction might be involved in the pathogenesis of AA.Among the IL-27 polymorphisms identified, the SNP of IL-27 rs153109 polymorphism has been reported to be associated with the risk of asthma, chronic obstructive pulmonary disease and inflammatory bowel diseases. To our knowledge, little is known about the role of the SNP of IL-27 in individual susceptibility to AA. To address this question, we have detected the IL-27 rs153109 polymorphism with an aim of identifying site(s) of variation, which may be helpful for better understanding the genetic influences of this gene. We herein performed a case-control study to investigate whether the IL-27 rs153109 polymorphism is associated with AA in Chinese people.
Aims
The aim of the present study was to investigate the association of single nucleotide polymorphisms (SNP) of IL-27 gene with the risk for aplastic anemia (AA).
Methods
Patients StudiedThe subjects comprised 205 AA patients (109 male and 96 female) with age range of (14–76 years) referred to our hospital, and 196 healthy controls from the employees of our hospital. The characteristics of the subjects are shown in Table 1.Extraction of Genomic DNAGenomic DNA was extracted using DNA Purification Kit (promega Cat. #A1125 Beijing, China) according to the manufacturer’s protocols. IL-27 rs153109 Genotyping by Polymerase Chain Reaction-restriction Fragment Length Polymorphism (PCR-RFLP)The genotyping of the TRAF1/C5 rs10818488 was performed by PCR-RFLP. The upstream primer 5΄- ACCAAGAAACCCCATCCTCT -3΄ and the downstream primer 5΄- TCAGTCAGTGACCAGGATCG -3΄ were used to generate a region of 224 bp of IL-27 gene. Genotyping for IL-27 rs153109 SNP was performed by restriction analysis using the PaeR7I restriction enzyme (New England Biolabs), which digests specifically DNA amplified from the G (but not the A) allele into 179-bp and 45-bp fragments. Both undigested and digested PCR products were visualized in 2% agarose gel stained with ethidium bromide. Genotypes were scored blindly, and analyses of all ambiguous samples were repeated.Statistical AnalysisSPSS16.0 (SPSS Inc., Chicago, IL) was used for statistics analysis. A p value <0.05 was considered to be statistically significant.
Results
In our study, the IL-27 rs153109 polymorphism genotypes between AA patients and healthy controls were first determined and compared. The frequencies of AA, AG and GG genotypes, and A and G alleles were 39.5%, 48.3%, 12.2%, 63.7% and 36.3%, respectively, in AA patients. There was no significant differences in terms of genotype and alleles distributions between AA patients and healthy controls (P=0.653 and 0.908, respectively).(Table 2). Furthermore, AA patients were further subdivided into three groups according to the disease serevity: vSAA, SAA, and NSAA. The distribution of this polymorphism genotype was compared between each of these three groups and the controls, respectively. No statistical differences were identified (Table 3).We also investigated whether the IL-27 rs153109 polymorphism could influence response to treatment. Nine of 205 (4.4%) patients were lost to follow-up. Responders included complete and partial responders. No significant correlations between the genotype and allele frequencies and response of treatment in this cohort of AA patients were observed (Table 4).
Conclusion
In conclusion, IL-27 rs153109 polymorphism may not play an important role as a genetic risk factor in the pathophysiology of AA in a Chinese population. More studies with larger sample are warranted to further confirm the role of IL-27 rs153109 polymorphism in determining the risk of AA.
Session topic: E-poster
Keyword(s): Aplastic anemia, Polymorphism
{{ help_message }}
{{filter}}